Root > Products > Predefined DNA/RNA > PTO-protected RNA > PTO protected RNA - Products
Product Contents Cat.no Price   Order
Random RNA-PTO-Hexamer 25 nmol 5-0411-210 USD 46.20  

Random RNA-oligonucleotides, phosphothioate (PTO) protected. ...

Further details, manuals, data sheets, related products and more
Random RNA-PTO-Hexamer 50 nmol 5-0411-211 USD 81.40  

Random RNA-oligonucleotides, phosphothioate (PTO) protected. ...

Further details, manuals, data sheets, related products and more
Random RNA-PTO-Hexamer 100 nmol 5-0411-212 USD 150.70  

Random RNA-oligonucleotides, phosphothioate (PTO) protected. ...

Further details, manuals, data sheets, related products and more
Random RNA-PTO-Hexamer 200 nmol 5-0411-213 USD 248.60  

Random RNA-oligonucleotides, phosphothioate (PTO) protected For cell-free cloning based on the multiple-primed rolling circle amplification (MPRCA) technique. RNA-PTO oligonucleotides avoid the formation of unwanted ligation products that form if DNA primers are used.

Complete phosphorothiate protected RNA; 20 mer, RNA 40 or 41 or 42, Cell Culture Grade 25 nmol 5-0515-553 USD 289.30  

As protection against nuclease degradation we are offering PTO protected RNA. RNA40=GCCCGUCUGUUGUGUGACUC RNA41=GCCCGACAGAAGAGAGACAC RNA42=ACCCAUCUAUUAUAUAACUC

Complete phosphorothiate protected RNA; 20 mer, RNA 40 or 41 or 42, Cell Culture Grade 100 nmol 5-0515-554 USD 612.70  

As protection against nuclease degradation we are offering PTO protected RNA. RNA40=GCCCGUCUGUUGUGUGACUC RNA41=GCCCGACAGAAGAGAGACAC RNA42=ACCCAUCUAUUAUAUAACUC