PTO protected RNA

Our ssRNA as well as our other RNA products are manufactured in state-of-the art facilities. Due to the phosphorothioate modifications, the stability of this kind of ssRNA-oligonucleotides is increased significantly. Quality is checked routinely according to our stringent quality standards and special care is taken to use only highest quality raw materials.

Our ssRNA products are especially recognized for their superior performance in cell culture assays looking for an immune response while avoiding any kind of endotoxin-related unspecific effects.

Amongst others, they have been used by a research group at the TU Munich to identify members of the Toll-like receptor (TLR) family as sensors for single stranded RNA.

Product Contents Price   Order
Random RNA-PTO-Hexamer 25 nmol 5-0411-210 USD 46.20  

Random RNA-oligonucleotides, phosphothioate (PTO) protected. ...

Further details, manuals, data sheets, related products and more
Random RNA-PTO-Hexamer 50 nmol 5-0411-211 USD 81.40  

Random RNA-oligonucleotides, phosphothioate (PTO) protected. ...

Further details, manuals, data sheets, related products and more
Random RNA-PTO-Hexamer 100 nmol 5-0411-212 USD 150.70  

Random RNA-oligonucleotides, phosphothioate (PTO) protected. ...

Further details, manuals, data sheets, related products and more
Random RNA-PTO-Hexamer 200 nmol 5-0411-213 USD 248.60  

Random RNA-oligonucleotides, phosphothioate (PTO) protected For cell-free cloning based on the multiple-primed rolling circle amplification (MPRCA) technique. RNA-PTO oligonucleotides avoid the formation of unwanted ligation products that form if DNA primers are used.

Complete phosphorothiate protected RNA; 20 mer, RNA 40 or 41 or 42, Cell Culture Grade 25 nmol 5-0515-553 USD 289.30  

As protection against nuclease degradation we are offering PTO protected RNA. RNA40=GCCCGUCUGUUGUGUGACUC RNA41=GCCCGACAGAAGAGAGACAC RNA42=ACCCAUCUAUUAUAUAACUC

Complete phosphorothiate protected RNA; 20 mer, RNA 40 or 41 or 42, Cell Culture Grade 100 nmol 5-0515-554 USD 612.70  

As protection against nuclease degradation we are offering PTO protected RNA. RNA40=GCCCGUCUGUUGUGUGACUC RNA41=GCCCGACAGAAGAGAGACAC RNA42=ACCCAUCUAUUAUAUAACUC